Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

Show Tags

public class Solution {
    public List<String> findRepeatedDnaSequences(String s) {
        List<String> res = new ArrayList<>();
        if (s == null || s.length() <= 10) {
            return res;
        }
        HashSet<Integer> set = new HashSet<Integer>();
        HashSet<Integer> set2 = new HashSet<Integer>();
       
        for (int i = 0; i <= s.length() - 10; i++) {
            int v = 0;
            for (int j = i; j < i + 10; j++) {
                char c = s.charAt(j);
                if (c == 'A') {
                    v |= 0;
                } else if (c == 'T') {
                    v |= 1;
                } else if (c == 'C') {
                    v |= 2;
                } else {
                    v |= 3;
                }
                v <<=2 ;
            }
            if (!set.add(v) && set2.add(v)) {
                res.add(s.substring(i, i + 10));
            }
        }
        return res;
    }
}